copy and paste this google map to your website or blog!
Press copy button and paste into your blog or website.
(Please switch to 'HTML' mode when posting into your blog. Examples: WordPress Example, Blogger Example)
Input Form:Deal with this potential dealer,buyer,seller,supplier,manufacturer,exporter,importer
(Any information to deal,buy, sell, quote for products or service)
PrimerBank - Harvard University The primer design algorithm has been extensively tested by real-time PCR experiments for PCR specificity and efficiency We have tested 26,855 primer pairs that correspond to 27,681 mouse genes by Real Time PCR followed by agarose gel electrophoresis and sequencing of the PCR products
PrimerBank - Harvard University The design success rate is 82 6% (22,187 successful primer pairs) based on agarose gel electrophoresis All experimental validation data for mouse primers are available from PrimerBank In order to view, please follow the appropriate links seen on the primer information page
PrimerBank - Harvard University The Quantitative PCR Primer Database (QPPD) provides information about primers and probes that can be used for human and mouse real time RT–PCR assays All data has been gathered from published articles, cited in PubMed
PrimerBank - Harvard University Athanasia Spandidos, Xiaowei Wang, Huajun Wang and Brian Seed: PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification
PrimerBank Search Result Primer Pair Descriptions: PrimerBank ID 26341538a1 Validation Results nbsp nbsp(Click here to view experimental validation data: amplification plots, dissociation curves, 2% agarose gel analysis, sequencing and BLAST data) Amplicon Size 184 Sequence (5' -> 3') Length Tm Location Forward Primer ATGGCAACTTGTACTCCAAGAAA 23 60 1 4-26 Reverse Primer
PrimerBank - Harvard University Submit your PCR primers to PrimerBank, a public resource for gene expression detection and quantification at Harvard University
PrimerBank Search Result Primer Pair Descriptions: PrimerBank ID 26337391a1 Validation Results nbsp nbsp(Click here to view experimental validation data: amplification plots, dissociation curves, 2% agarose gel analysis, sequencing and BLAST data) Amplicon Size 102 Sequence (5' -> 3') Length Tm Location Forward Primer ATGGAGGTCTCCGAGAACG 19 60 5 1-19 Reverse Primer
PrimerBank Search Result Primer Pair Descriptions: PrimerBank ID 26342118a1 Validation Results nbsp nbsp(Click here to view experimental validation data: amplification plots, dissociation curves, 2% agarose gel analysis, sequencing and BLAST data) Amplicon Size 135 Sequence (5' -> 3') Length Tm Location Forward Primer GGAAGCCTGAAGGTAGACTTTC 22 60 0 271-292 Reverse Primer
PrimerBank Search Result Primer Pair Descriptions: PrimerBank ID 30425316a1 Validation Results nbsp nbsp(Click here to view experimental validation data: amplification plots, dissociation curves, 2% agarose gel analysis, sequencing and BLAST data) Amplicon Size 143 Sequence (5' -> 3') Length Tm Location Forward Primer AGTGGAAACCAAAAATTCTGGCT 23 60 9 2664-2686 Reverse
PrimerBank Search Result Primer Pair Descriptions: PrimerBank ID 31982461a1 Validation Results nbsp nbsp(Click here to view experimental validation data: amplification plots, dissociation curves, 2% agarose gel analysis, sequencing and BLAST data) Amplicon Size 82 Sequence (5' -> 3') Length Tm Location Forward Primer GCTCCTGGTTCTAGGGTCATC 21 61 3 66-86 Reverse Primer