companydirectorylist.com  Global Business Directories and Company Directories
Search Business,Company,Industry :


Country Lists
USA Company Directories
Canada Business Lists
Australia Business Directories
France Company Lists
Italy Company Lists
Spain Company Directories
Switzerland Business Lists
Austria Company Directories
Belgium Business Directories
Hong Kong Company Lists
China Business Lists
Taiwan Company Lists
United Arab Emirates Company Directories


Industry Catalogs
USA Industry Directories












Company Directories & Business Directories

PTS Professional Technical Systems Kälte & Klimaanlagenbau Service- u HandelsgmbH

1230 Wien-Austria

Company Name:
Corporate Name:
PTS Professional Technical Systems Kälte & Klimaanlagenbau Service- u HandelsgmbH
Company Title:  
Company Description:  
Keywords to Search:  
Company Address: Erlaaer Str 39,1230 Wien,,Austria 
ZIP Code:
Postal Code:
 
Telephone Number:  
Fax Number:  
Website:
 
Email:
 
Number of Employees:
 
Sales Amount:
 
Credit History:
Credit Report:
 
Contact Person:
 
Remove my name



copy and paste this google map to your website or blog!

Press copy button and paste into your blog or website.
(Please switch to 'HTML' mode when posting into your blog. Examples:
WordPress Example, Blogger Example)









Input Form:Deal with this potential dealer,buyer,seller,supplier,manufacturer,exporter,importer

(Any information to deal,buy, sell, quote for products or service)

Your Subject:
Your Comment or Review:
Security Code:



Previous company profile:
Puchinger & Preimesberger Transport OEG
Pusch Renate - Kleintransporte
Pichler Ulrike
Next company profile:
PA Pichlmüller Apparatebau GmbH
PA Pichlmüller Apparatebau GesmbH
Prima Klima Klimagerätehandels GmbH










Company News:
  • Solved Piikani Tool and Supply Corp. (PTS) is an | Chegg. com
    During 2 0 2 3, PTS introduced a new program called No Late Fees Under the program, customers do not pay late fees for light tools that are not returned on time If a tool is not returned within 3 0 days, PTS considers the tool to be sold to the customer who rented it and the customer is charged $ 3 0 0, which is the average cost of a
  • Chegg - Get 24 7 Homework Help | Rent Textbooks
    Chegg provides homework help, textbook rentals, and study tools to support students in their academic journey
  • Solved ( 25 pts ) Determine the global stiffness matrix K - Chegg. com
    ( 25 pts ) Determine the global stiffness matrix K for the truss structure shown Use a crosssectional area of A=2in2 and a modulus of elasticity E=29,000ksi Then, using the stiffness matrix method, calculate the displacements at joints 1 and 3 , and the horizontal displacement at joint 2
  • Solved Question 1 1 pts The first step in assessing the - Chegg
    Question 1 1 pts The first step in assessing the evolutionary path of the three equine species is to transcribe their mitochondrial DNA to RNA A mitochondrial gene from a zebra is found on the top strand: DNA (3' end) GATACCCATAAGCAGGGATGACTGTTG
  • Solved Examine the given network: (Suggestion: Supermesh or - Chegg. com
    Examine the given network:(Suggestion: Supermesh or Source Conversions)a Determine the current I2 with direction pts )b What is the voltage across the current source, VIs, with polarity?(5 pts )c Calculate the power being delivered to R3,PR3 ( 5pts )d What is the voltage at point a in the network? (5 pts )e
  • Chegg Study Questions and Answers | Chegg. com
    Questions and Answers from Chegg At Chegg we understand how frustrating it can be when you’re stuck on homework questions, and we’re here to help
  • Solved ( 15 pts ) Draw typical schematic of NFET | Chegg. com
    ( 15 pts ) Draw typical schematic of NFET common-source amplifier with a signal of 50 mV applied directly tothe gate Let RD=50kΩ,VDD=3 3VμnCox'=0 2mAV2,WL=4 and Vtn=0 4V Solve for VGS and ID needed toachieve the proper gm and a voltage gain of -10VV Draw a load line and an I-V curve, mark VDS and Q-point
  • Solved Exercice 2 : Violon versus diapason ( 8 pts)Le - Chegg
    Exercice 2 : Violon versus diapason ( 8 pts)Le violon est un instrument à cordes frottées par un archer ; ces cordessont solidaires d'une caisse de résonance en bois La figure 1 représentel'enregistrement du son émis par un violon de niveau d'intensité sonore L=58dB 1
  • Solved by an EXPERT Problem 5-10 ptsConsider a blackbody at . . . - Chegg
    Answer to Problem 5-10 ptsConsider a blackbody at 2000 K Your solution’s ready to go! Our expert help has broken down your problem into an easy-to-learn solution you can count on
  • Solved Problem 3. ( 25 Pts)You are working as a naval - Chegg
    Problem 3 ( 25 Pts)You are working as a naval engineer researching different ways to reduce the fuel costs for ships One company suggests attaching a parachute-like sail near the front of a ship to reduce the required power output from the engine To analyze the effectiveness of this design, consider a 130-m-long ship




Business Directories,Company Directories
Business Directories,Company Directories copyright ©2005-2012 
disclaimer